missing translation for 'onlineSavingsMsg'
Learn More
Learn More
Thermo Scientific™ M13/pUC Reverse Sequencing Primer (-46), 24-mer
Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.
Brand: Thermo Scientific™ SO115
261.00 SEK valid until 2024-12-20
Use promo code "21651" to get your promotional price.
This item is not returnable.
View return policy
Description
Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR
Primer Sequence: 5'-d(GAGCGGATAACAATTTCACACAGG)-3'
Specifications
| Sequencing Primer | |
| Dry Ice | |
| M13 | |
| pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II | |
| Liquid |
| M13/pUC Reverse Sequencing Primer (-46), 24-mer, 10 μM (42 μL) Store at –20°C. |
|
| 10 μM | |
| 42 μL | |
| Sequencing |
For Research Use Only. Not for use in diagnostic procedures.